Neoplasms

Digestive System Diseases

All Conditions

Symptoms and General Pathology

Infections

Rare Diseases

Colonic Neoplasms

Syndrome

Communicable Diseases

Postoperative Complications

Intestinal Obstruction

Systemic Inflammatory Response Syndrome

Colorectal Neoplasms

Intestinal Neoplasms

Gastrointestinal Neoplasms

Digestive System Neoplasms

Gastrointestinal Diseases

Colonic Diseases

Intestinal Diseases

Inflammation

Shock

Acute Graft Versus Host Disease

Herbal and Botanical

All Drugs and Chemicals

Cola

60 patients with malignant acute bowel obstruction

60 colorectal cancer patients without acute bowel obstruction (planned operations)

30 patients with benign acute bowel obstruction

Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.

Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.

sCD14-ST

Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method.

16s rRNA

Yemek Turgunov, Pr.

Alina Ogizbayeva, PhD student

Lyudmila Akhmaltdinova, PhD

Kairat Shakeyev, Pr.

Dmitry Matyushko, PhD

Miras Mugazov, PhD

Asylbek Zhumakaev, Master

Irina Kadyrova, PhD

Despite modern approaches to the diagnosis and treatment of acute bowel obstruction (ABO), postoperative mortality ranges from 5 to 32%, and complications occur up 23% of cases. One of the formidable infectious and inflammatory complications of ABO is sepsis. The main component of the development of sepsis in ABO is bacterial translocation (BT). BT is the migration of intestinal bacteria or their products through the intestinal mucosa into the mesenteric lymph nodes and further into normally sterile tissues and organs.

Today there are several methods for detecting BT:

1. direct method - the detection of 16s rRNA (ribosomal ribonucleic acid) in mesenteric lymph nodes (MLN);
2. indirect method - the detection of serum lipopolysaccharide-binding protein (LBP) and presepsin (Soluble CD14 subtype or sCD14-ST).

The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation (LBP, sCD14-ST) with the detection of microorganism genes (16s rRNA) in mesenteric lymph nodes.

For the early diagnosis of infectious and inflammatory complications, it is necessary to study LBP, sCD-14 and 16sRNA as bacterial translocation markers in patients with malignant and benign acute bowel obstruction, as well as in patients after planned surgical intervention for colon tumors. Based on changes in bacterial translocation biomarkers in the blood serum, it's suggested that patients with researched pathology can be stratified according to the risk level of developing infectious and inflammatory complications.

The study materials are blood serum and mesenteric lymph nodes (MLN). Venous blood sampling will be performed 1 hour before surgery, 24 and 72 hours after it. Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator. It will be centrifuged for 20 minutes at 1000 x g, after which the gel completely separates the serum from the clot, forming a tight barrier.ELISA Kit for Lipopolysaccharide Binding Protein (LBP, Human) and for Presepsin (sCD14-ST, Human), from Cloud-Clone Corp. will be used to determine any presence of LBP and sCD14-ST. The analysis will be performed according to the manufacturer's instructions for an ELISA EVOLIS robotic system from BioRad.

The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen. MLN will be placed in a sterile tube without any fillers. The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific, USA, in accordance with the manufacturer's instructions. The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers (U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC).

During the implementation, the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company (NJSC) "Karaganda Medical University" will be used.

This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. AP09260597).

Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Bowel Obstruction

Prognostic Significance of Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Mechanical Bowel Obstruction

Аny infectious and inflammatory complications in post-operative period (wound suppuration, anastomotic leak, аbdominal abscesses, peritonitis, sepsis, etc.)

LBP levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.

sCD14-ST levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.

Presence or absence of 16s rRNA in mesenteric lymph nodes will be compared between groups/subgroups.

Study title	NCT ID	Conditions	Interventions	Eligibility	Organization	Link
Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Bowel Obstruction	NCT05229822	Intestinal Obst... Colorectal Canc... Post-Op Complic... Systemic Inflam... Colon Tumor	LBP sCD14-ST 16s rRNA	18 Years -	Karaganda Medical University
Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Bowel Obstruction	NCT05229822	Intestinal Obst... Colorectal Canc... Post-Op Complic... Systemic Inflam... Colon Tumor	LBP sCD14-ST 16s rRNA	18 Years -	Karaganda Medical University

Spots Global Cancer Trial Database for 16s rrna

Every month we try and update this database with for 16s rrna cancer trials from around the world to help patients and their families find trials that might be right for them.
We offer this 100% free of charge and do not endorse any of the trials listed here, we hope it helps you or a loved one.

Spots Global Cancer Trial Database for 16s rrna

Every month we try and update this database with for 16s rrna cancer trials from around the world to help patients and their families find trials that might be right for them. We offer this 100% free of charge and do not endorse any of the trials listed here, we hope it helps you or a loved one.

Every month we try and update this database with for 16s rrna cancer trials from around the world to help patients and their families find trials that might be right for them.
We offer this 100% free of charge and do not endorse any of the trials listed here, we hope it helps you or a loved one.