Neoplasms

Digestive System Diseases

All Conditions

Colonic Neoplasms

Herbal and Botanical

All Drugs and Chemicals

Cola

GAEL ROTH, MD, PHD

ARNAUD MILLET, MD, PHD

ARNAUD MILLET, MD,PHD

Colorectal cancer is the third most common cancer worldwide and its progression-free survival is still low, around 10 months. Thirthy to 50% of patients do not respond to chemotherapy upon initiation of treatment, suggesting that early development of chemoresistance mechanisms remains a major challenge. In order to better characterize these mechanisms, the aim is to develop a model of tumoroids derived from patients with a colorectal tumors prior to any systemic anti cancer treatment. This project will both allow us to study the role of the immunological microenvironment in chemoresistance and identify new predictive markers of tumor response. It will then serve to develop innovative personalized medicine strategies by targeting the newly identified mechanisms. This study should in fine help to improve the cancer patient's care.

Tumor Immune Microenvironment Involvement in Colorectal Cancer Chemoresistance Mechanisms

Tumor Immune Microenvironment Involvement in Colorectal Cancer Chemoresistance Mechanisms: a Patient-derived Tumoroids Prospective Collection From Systemic Treatment Naive Tumors

University Hospital, Grenoble

Symptoms and General Pathology

Infections

Rare Diseases

Syndrome

Communicable Diseases

Postoperative Complications

Intestinal Obstruction

Systemic Inflammatory Response Syndrome

Colorectal Neoplasms

Intestinal Neoplasms

Gastrointestinal Neoplasms

Digestive System Neoplasms

Gastrointestinal Diseases

Colonic Diseases

Intestinal Diseases

Inflammation

Shock

Acute Graft Versus Host Disease

60 patients with malignant acute bowel obstruction

60 colorectal cancer patients without acute bowel obstruction (planned operations)

30 patients with benign acute bowel obstruction

Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.

Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.

sCD14-ST

Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method.

16s rRNA

Yemek Turgunov, Pr.

Alina Ogizbayeva, PhD student

Lyudmila Akhmaltdinova, PhD

Kairat Shakeyev, Pr.

Dmitry Matyushko, PhD

Miras Mugazov, PhD

Asylbek Zhumakaev, Master

Irina Kadyrova, PhD

Despite modern approaches to the diagnosis and treatment of acute bowel obstruction (ABO), postoperative mortality ranges from 5 to 32%, and complications occur up 23% of cases. One of the formidable infectious and inflammatory complications of ABO is sepsis. The main component of the development of sepsis in ABO is bacterial translocation (BT). BT is the migration of intestinal bacteria or their products through the intestinal mucosa into the mesenteric lymph nodes and further into normally sterile tissues and organs.

Today there are several methods for detecting BT:

1. direct method - the detection of 16s rRNA (ribosomal ribonucleic acid) in mesenteric lymph nodes (MLN);
2. indirect method - the detection of serum lipopolysaccharide-binding protein (LBP) and presepsin (Soluble CD14 subtype or sCD14-ST).

The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation (LBP, sCD14-ST) with the detection of microorganism genes (16s rRNA) in mesenteric lymph nodes.

For the early diagnosis of infectious and inflammatory complications, it is necessary to study LBP, sCD-14 and 16sRNA as bacterial translocation markers in patients with malignant and benign acute bowel obstruction, as well as in patients after planned surgical intervention for colon tumors. Based on changes in bacterial translocation biomarkers in the blood serum, it's suggested that patients with researched pathology can be stratified according to the risk level of developing infectious and inflammatory complications.

The study materials are blood serum and mesenteric lymph nodes (MLN). Venous blood sampling will be performed 1 hour before surgery, 24 and 72 hours after it. Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator. It will be centrifuged for 20 minutes at 1000 x g, after which the gel completely separates the serum from the clot, forming a tight barrier.ELISA Kit for Lipopolysaccharide Binding Protein (LBP, Human) and for Presepsin (sCD14-ST, Human), from Cloud-Clone Corp. will be used to determine any presence of LBP and sCD14-ST. The analysis will be performed according to the manufacturer's instructions for an ELISA EVOLIS robotic system from BioRad.

The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen. MLN will be placed in a sterile tube without any fillers. The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific, USA, in accordance with the manufacturer's instructions. The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers (U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC).

During the implementation, the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company (NJSC) "Karaganda Medical University" will be used.

This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. AP09260597).

Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Bowel Obstruction

Prognostic Significance of Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Mechanical Bowel Obstruction

Аny infectious and inflammatory complications in post-operative period (wound suppuration, anastomotic leak, аbdominal abscesses, peritonitis, sepsis, etc.)

LBP levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.

sCD14-ST levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.

Presence or absence of 16s rRNA in mesenteric lymph nodes will be compared between groups/subgroups.

Ministry of Education and Science, Republic of Kazakhstan

Karaganda Medical University

Skin and Connective Tissue Diseases

Stomach Neoplasms

Rectal Neoplasms

Gastrointestinal Stromal Tumors

Neoplasms, Connective Tissue

Neoplasms, Connective and Soft Tissue

Neoplasms by Histologic Type

Stomach Diseases

Rectal Diseases

Stomach Cancer

Adult patients undergoing an elective, primary surgery within the gastrointestinal tract with the need for anastomosis.

Wenceslao Vasquez Jimenez, Dr.

The primary aim of this study is to collect clinical data on the performance of MonoPlus® suture applied in routine clinical practice. Diverse parameters are to be used to assess the safety and efficacy of MonoPlus® suture for gastrointestinal anastomosis construction.

This study has been designed to implement an action within the framework of a proactive Post Market Clinical Follow up (PMCF) activity.

Gastrointestinal Anastomosis Using MonoPlus® Suture

Assessment of MonoPlus® Suture Material for Anastomosis in the Gastrointestinal Tract. A Prospective, Multi-centric, International, Single-arm, Observational Study in Daily Practice

The primary endpoint of this study is the anastomosis leakage rate until 6 months after surgery

Comparison of the dehiscence rate of the suture line at different postoperative examinations

Comparison of the Peritonitis rate of the suture line at different postoperative examinations

Incidence of postoperative surgical site infections, SSI (A1: Superficial incisional site infections and A2: Deep incisional surgical site infections) (efficacy parameter) Surgical Site Infection (SSI) is defined according to the definition of the US Centres for Disease Control and Prevention (CDC) at different postoperative examinations.

Comparison of postoperative Bleeding rate at different postoperative examinations

Comparison of postoperative Abscess rate at different postoperative examinations

Comparison of postoperative Fistula rate at different postoperative examinations

Comparison of postoperative Perforation rate at different postoperative examinations

Comparison of postoperative Obstipation rate at different postoperative examinations

Comparison of postoperative Stenosis rate at different postoperative examinations

Comparison of Reoperation rate due to an anastomosis leakage at different postoperative examinations

Comparison of postoperative Mortality rate at different postoperative examinations

Comparison of postoperative Stoma rate at different postoperative examinations

Number of days between date of surgery and date of discharge

Number of days the patient has to stay in the intensive care unit after the intervention

Time in Minutes the surgeon needs to perform the anastomosis

EQ-5D-5L is a standardized measure of health status developed by EuroQol Group in order to provide a simple, generic measure of health for clinical and economic appraisal. EQ-5D-5L is designed for self-completion by respondents and it takes only a few minutes to complete. Instructions to respondents are included in the questionnaire. EQ-5D-5L consists of 2 pages - descriptive system and the EQ visual Analogue scale (EQ-VAS). The descriptive system comprises 5 dimensions (mobility, self care, usual activities, pain/discomfort, anxiety/depression). Each dimension has 5 levels: no problems, slight problems, moderate problems, severe problems and extreme problems. The EQ VAS records the respondents self rated health on a 20 cm vertical , visual analogue scale with endpoints labelled "the best health you can imagine" and " the worst health you can imagine"

This parameter will be noted using the Visual Analogue Scale (VAS) which state "0" at one end representing "no pain" and "100" at the opposite end representing "maximal pain". The values are compared over postoperative period.

Assessment of the handling of the suture material intra-operatively using a questionnaire including different dimensions (knot security, tensile strength, knot run down, stiffness) with 5 evaluation levels (excellent, very good, good, satisfied, poor).

B.Braun Surgical SA

Aesculap AG

Ulf Gustafsson, MD, PhD

Register study. Patients who had been operated for right-sided colon tumor or benign adenoids between year 2011 to 2012. The study compare open surgery with laparoscopic surgery in an ERAS (Enhanced Recovery After Surgery) protocol.

Hypothesis:

Operation of right-sided colon tumor and large benign adenoids, a better selection of patients for open or laparoscopic surgery can improve short term results.

Right-sided Colon Tumor, Laparoscopic Versus Open Surgery, in an ERAS Protocol

Right-sided Colon Tumor, Laparoscopic and Open Surgery, in an ERAS Protocol

After PAD result, malign or benign tumor, type of malign tumor,tumor growth, stage, lymphatic recharge.

Right selection of patients to laparoscopic versus open surgery in relation to PAD result?

Inflammation answer laparoscopic versus open surgery

Danderyd Hospital

Region Örebro County

Ersta Hospital, Sweden

Karolinska Institutet

MD, PhD

Gland and Hormone Related Diseases

Respiratory Tract (Lung and Bronchial) Diseases

Urinary Tract, Sexual Organs, and Pregnancy Conditions

Esophageal Neoplasms

Breast Neoplasms

Pancreatic Neoplasms

Melanoma

Head and Neck Neoplasms

Neoplasm Metastasis

Lung Neoplasms

Endometrial Neoplasms

Urologic Neoplasms

Neuroendocrine Tumors

Neuroectodermal Tumors

Neuroectodermal Tumors, Primitive

Neoplasms, Germ Cell and Embryonal

Neoplasms, Nerve Tissue

Nevus, Pigmented

Nevus

Nevi and Melanomas

Skin Neoplasms

Skin Diseases

Endocrine Gland Neoplasms

Pancreatic Diseases

Endocrine System Diseases

Esophageal Diseases

Uterine Neoplasms

Genital Neoplasms, Female

Urogenital Neoplasms

Uterine Diseases

Genital Diseases, Female

Genital Diseases

Urogenital Diseases

Female Urogenital Diseases

Pregnancy Complications

Female Urogenital Diseases and Pregnancy Complications

Neoplastic Processes

Breast Diseases

Respiratory Tract Neoplasms

Thoracic Neoplasms

Lung Diseases

Respiratory Tract Diseases

Male Urogenital Diseases

Urologic Diseases

Esophageal Cancer

Pancreatic Cancer

Neuroendocrine Tumor

Neuroepithelioma

Antineoplastic Agents

Niraparib

Poly(ADP-ribose) Polymerase Inhibitors

Enzyme Inhibitors

Eligible participants will receive daily dosing of Niraparib.

Anjali Avadhani, MD

The purpose of this study is to further evaluate the efficacy and safety of niraparib in patients with locally advanced or metastatic solid tumors and a pathogenic or likely pathogenic tumor PALB2 (tPALB2) mutation.

Niraparib in the Treatment of Patients With Advanced PALB2 Mutated Tumors

A Single-Arm Phase-II Study of Niraparib in Locally Advanced or Metastatic Solid Tumor Patients With PALB2 Mutations

To evaluate overall response rate (ORR) as assessed by Independent Central Review (ICR) using RECIST v1.1

To evaluate duration of response (DOR) as assessed by ICR using RECIST v1.1

To evaluate progression-free survival (PFS) as assessed by ICR using Response Evaluation Criteria in Solid Tumors version 1.1 (RECIST v1.1)

To evaluate ORR as assessed by Investigator using RECIST v1.1

To evaluate DOR as assessed by Investigator using RECIST v1.1

To evaluate PFS as assessed by Investigator using RECIST v1.1

To evaluate Clinical Benefit Rate (CBR) as assessed by ICR and Investigator

To evaluate intracranial ORR in participants with untreated measurable CNS lesions as assessed by Investigator using RECIST v1.1

To evaluate intracranial ORR in participants with untreated measurable CNS lesions as assessed by ICR using RECIST v1.1

To evaluate safety and tolerability per the National Cancer Institute Common Terminology Criteria for Adverse Events version 5.0 (NCI-CTCAE v5.0)

Study title	NCT ID	Conditions	Interventions	Eligibility	Organization
Tumor Immune Microenvironment Involvement in Colorectal Cancer Chemoresistance Mechanisms	NCT05038358	Primary Tumor Colon Tumor		18 Years -	University Hospital, Grenoble
Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Bowel Obstruction	NCT05229822	Intestinal Obst... Colorectal Canc... Post-Op Complic... Systemic Inflam... Colon Tumor	LBP sCD14-ST 16s rRNA	18 Years -	Karaganda Medical University
Gastrointestinal Anastomosis Using MonoPlus® Suture	NCT04811833	Gastrointestina... Gastrointestina... Digestive Syste... Stomach Tumor Small Intestine... Colon Tumor Rectum Tumor		18 Years -	Aesculap AG
Right-sided Colon Tumor, Laparoscopic Versus Open Surgery, in an ERAS Protocol	NCT01831245	Colon Tumor		18 Years -	Karolinska Institutet
Niraparib in the Treatment of Patients With Advanced PALB2 Mutated Tumors	NCT05169437	Solid Tumor Breast Tumor Colon Tumor, Ma... Lung Tumor Urologic Cancer Pancreatic Canc... Melanoma Metastatic Canc... Locally Advance... Esophageal Canc... Endometrial Can... Head and Neck C...	Niraparib	18 Years -	Tempus AI
Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Bowel Obstruction	NCT05229822	Intestinal Obst... Colorectal Canc... Post-Op Complic... Systemic Inflam... Colon Tumor	LBP sCD14-ST 16s rRNA	18 Years -	Karaganda Medical University
Gastrointestinal Anastomosis Using MonoPlus® Suture	NCT04811833	Gastrointestina... Gastrointestina... Digestive Syste... Stomach Tumor Small Intestine... Colon Tumor Rectum Tumor		18 Years -	Aesculap AG
Tumor Immune Microenvironment Involvement in Colorectal Cancer Chemoresistance Mechanisms	NCT05038358	Primary Tumor Colon Tumor		18 Years -	University Hospital, Grenoble
Niraparib in the Treatment of Patients With Advanced PALB2 Mutated Tumors	NCT05169437	Solid Tumor Breast Tumor Colon Tumor, Ma... Lung Tumor Urologic Cancer Pancreatic Canc... Melanoma Metastatic Canc... Locally Advance... Esophageal Canc... Endometrial Can... Head and Neck C...	Niraparib	18 Years -	Tempus AI

Spots Global Cancer Trial Database for colon tumor

Every month we try and update this database with for colon tumor cancer trials from around the world to help patients and their families find trials that might be right for them.
We offer this 100% free of charge and do not endorse any of the trials listed here, we hope it helps you or a loved one.

Spots Global Cancer Trial Database for colon tumor

Every month we try and update this database with for colon tumor cancer trials from around the world to help patients and their families find trials that might be right for them. We offer this 100% free of charge and do not endorse any of the trials listed here, we hope it helps you or a loved one.

Every month we try and update this database with for colon tumor cancer trials from around the world to help patients and their families find trials that might be right for them.
We offer this 100% free of charge and do not endorse any of the trials listed here, we hope it helps you or a loved one.